addgene 118846 Search Results


mcr braf v600e  (Addgene inc)
93
Addgene inc mcr braf v600e
Macrophages preferentially phagocytose TIE:EGFP + cells. (A) UMAP depicting mitfa, sox10, and marco expression in clusters identified by SORT-seq, combined 2 MCR:MCS replicates. Inset shows expression of these genes in the macrophage cluster. (B) Representative image from a zebrafish melanoma acquired on an upright confocal, n=5 fish. Melanoma is blue, macrophages are red, and TIE:EGFP + cells are green. Yellow indicates a macrophage that has phagocytosed a TGFb positive non-melanoma cell. Cyan indicates a TIE:EGFP + melanoma cell. When phagocytosed by macrophages, TIE:EGFP + melanoma cells appear white. (C) Representative TIE:EGFP + ; mpeg:mCherry + ;mitfa:BRAF <t>V600E</t> ;2x:U6 p53/Tyr gRNA mitfa:Cas9 ; mitfa:BFP + melanoma for flow analysis of macrophages. Scale bars indicate 1000µm. (D) Left: Viable cells were separated into TIE:EGFP - and TIE:EGFP + . Middle: FACs plots showing TIE:EGFP - and TIE:EGFP + cells relative to mpeg:mCherry and mitfa:BFP . Q1 and Q2 represent TIE:EGFP - cells that were phagocytosed by macrophages. Q2 contains BFP + melanoma cells that were phagocytosed, while Q1 contains non-melanoma cells that were phagocytosed. Right: The percentages in Q1 and Q2 were summed, to represent the total percentage of TIE:EGFP - or TIE:EGFP + cells phagocytosed by macrophages. Two-tailed unpaired Welch’s t- test was used to calculate significance. n=3 fish with two technical replicates each.
Mcr Braf V600e, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/addgene+118846/MiniCoopR+mitfa%3ABRAF+(Plasmid+%23118846)/bio_rxiv__2022__09__29__510035-166-9-11
Average 93 stars, based on 1 article reviews
mcr braf v600e - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

Image Search Results


Macrophages preferentially phagocytose TIE:EGFP + cells. (A) UMAP depicting mitfa, sox10, and marco expression in clusters identified by SORT-seq, combined 2 MCR:MCS replicates. Inset shows expression of these genes in the macrophage cluster. (B) Representative image from a zebrafish melanoma acquired on an upright confocal, n=5 fish. Melanoma is blue, macrophages are red, and TIE:EGFP + cells are green. Yellow indicates a macrophage that has phagocytosed a TGFb positive non-melanoma cell. Cyan indicates a TIE:EGFP + melanoma cell. When phagocytosed by macrophages, TIE:EGFP + melanoma cells appear white. (C) Representative TIE:EGFP + ; mpeg:mCherry + ;mitfa:BRAF V600E ;2x:U6 p53/Tyr gRNA mitfa:Cas9 ; mitfa:BFP + melanoma for flow analysis of macrophages. Scale bars indicate 1000µm. (D) Left: Viable cells were separated into TIE:EGFP - and TIE:EGFP + . Middle: FACs plots showing TIE:EGFP - and TIE:EGFP + cells relative to mpeg:mCherry and mitfa:BFP . Q1 and Q2 represent TIE:EGFP - cells that were phagocytosed by macrophages. Q2 contains BFP + melanoma cells that were phagocytosed, while Q1 contains non-melanoma cells that were phagocytosed. Right: The percentages in Q1 and Q2 were summed, to represent the total percentage of TIE:EGFP - or TIE:EGFP + cells phagocytosed by macrophages. Two-tailed unpaired Welch’s t- test was used to calculate significance. n=3 fish with two technical replicates each.

Journal: bioRxiv

Article Title: A chronic signaling TGFb zebrafish reporter identifies immune response in melanoma

doi: 10.1101/2022.09.29.510035

Figure Lengend Snippet: Macrophages preferentially phagocytose TIE:EGFP + cells. (A) UMAP depicting mitfa, sox10, and marco expression in clusters identified by SORT-seq, combined 2 MCR:MCS replicates. Inset shows expression of these genes in the macrophage cluster. (B) Representative image from a zebrafish melanoma acquired on an upright confocal, n=5 fish. Melanoma is blue, macrophages are red, and TIE:EGFP + cells are green. Yellow indicates a macrophage that has phagocytosed a TGFb positive non-melanoma cell. Cyan indicates a TIE:EGFP + melanoma cell. When phagocytosed by macrophages, TIE:EGFP + melanoma cells appear white. (C) Representative TIE:EGFP + ; mpeg:mCherry + ;mitfa:BRAF V600E ;2x:U6 p53/Tyr gRNA mitfa:Cas9 ; mitfa:BFP + melanoma for flow analysis of macrophages. Scale bars indicate 1000µm. (D) Left: Viable cells were separated into TIE:EGFP - and TIE:EGFP + . Middle: FACs plots showing TIE:EGFP - and TIE:EGFP + cells relative to mpeg:mCherry and mitfa:BFP . Q1 and Q2 represent TIE:EGFP - cells that were phagocytosed by macrophages. Q2 contains BFP + melanoma cells that were phagocytosed, while Q1 contains non-melanoma cells that were phagocytosed. Right: The percentages in Q1 and Q2 were summed, to represent the total percentage of TIE:EGFP - or TIE:EGFP + cells phagocytosed by macrophages. Two-tailed unpaired Welch’s t- test was used to calculate significance. n=3 fish with two technical replicates each.

Article Snippet: MCR:SATB2 and MCR:MCS are from Fazio et al . MCR:BRAF V600E (Addgene #118846) and 2xU6:p53/tyr gRNA mitfa:Cas9 (Addgene #118844) are published ( tyr gRNA= GGACTGGAGGACTTCTGGGG; p53 gRNA= GGTGGGAGAGTGGATGGCTG) .

Techniques: Expressing, Two Tailed Test

SATB2 expressing melanomas exhibit TIE:EGFP expression in early initiating melanomas. (A) Development of a representative tumor overexpressing MCR:SATB2 in TIE:EGFP Tg(mitf:BRAF V600E ); p53 −/− ; mitfa −/− zebrafish. Arrowhead indicates TIE:EGFP + early melanoma before tumor formation. (B) UMAP depicting mitfa, sox10, and marco expression in clusters identified by SORT-seq of SATB2 expressing tumor in . Inset shows expression of these genes in the macrophage cluster. (C) Dotplot depicting extracellular matrix TGFb target gene expression in TIE:EGFP high , TIE:EGFP low , and TIE:EGFP - SATB2 expressing melanoma cells. (D) Early initiating melanoma (arrowhead) overexpressing MCR:SATB2 in TIE:EGFP;Tg(mitf:BRAF V600E ); p53 −/− ; mitfa −/− zebrafish. Representative images chosen. 40% of MCR:SATB2 early melanomas express TIE:EGFP , compared to 0% of MCR:MCS tumors (quantification on right).

Journal: bioRxiv

Article Title: A chronic signaling TGFb zebrafish reporter identifies immune response in melanoma

doi: 10.1101/2022.09.29.510035

Figure Lengend Snippet: SATB2 expressing melanomas exhibit TIE:EGFP expression in early initiating melanomas. (A) Development of a representative tumor overexpressing MCR:SATB2 in TIE:EGFP Tg(mitf:BRAF V600E ); p53 −/− ; mitfa −/− zebrafish. Arrowhead indicates TIE:EGFP + early melanoma before tumor formation. (B) UMAP depicting mitfa, sox10, and marco expression in clusters identified by SORT-seq of SATB2 expressing tumor in . Inset shows expression of these genes in the macrophage cluster. (C) Dotplot depicting extracellular matrix TGFb target gene expression in TIE:EGFP high , TIE:EGFP low , and TIE:EGFP - SATB2 expressing melanoma cells. (D) Early initiating melanoma (arrowhead) overexpressing MCR:SATB2 in TIE:EGFP;Tg(mitf:BRAF V600E ); p53 −/− ; mitfa −/− zebrafish. Representative images chosen. 40% of MCR:SATB2 early melanomas express TIE:EGFP , compared to 0% of MCR:MCS tumors (quantification on right).

Article Snippet: MCR:SATB2 and MCR:MCS are from Fazio et al . MCR:BRAF V600E (Addgene #118846) and 2xU6:p53/tyr gRNA mitfa:Cas9 (Addgene #118844) are published ( tyr gRNA= GGACTGGAGGACTTCTGGGG; p53 gRNA= GGTGGGAGAGTGGATGGCTG) .

Techniques: Expressing, Targeted Gene Expression